12.6 Bioperl

The Bioperl project is an important collection of Perl code for bioinformatics that has been in development since 1998. Although Bioperl uses the more advanced object-oriented style of Perl program design, it's possible to take an introductory look here at how it's organized and used.

The main focus of Bioperl modules is to perform sequence manipulation, provide access to various biology databases (both local and web-based), and parse the output of various programs.

Bioperl is available at http://www.bioperl.org/. Some of its features rely on having additional Perl modules—available from CPAN (http://www.cpan.org/)—installed. This situation is quite common, and as you do more Perl programming, you'll become familiar with installing modules from CPAN. The Bioperl tutorials include information on installing Bioperl and additional modules for the three major operating systems: Unix or Linux, Mac, and Windows.

Bioperl doesn't provide complete programs. Rather, it provides a fairly large—and growing—set of modules for accomplishing common tasks, including some tasks you've seen in this book. You're responsible for writing the code that holds the modules together. By providing these ready and (usually) easy-to-use modules, Bioperl makes developing bioinformatics applications in Perl faster and easier. There are example programs for most of the modules, which can be examined and modified to get started.

Like many open source projects, Bioperl has suffered from fragmentation and uneven documentation, due to the strictly volunteer and geographically dispersed group of contributors. But recent work on the project leading up to Release 0.7 in March 2001 has significantly improved the project. In particular, there is now enough tutorial information on using the modules to enable you to make good use of the code.

Some difficulties still remain. Most of the code has been developed on Unix or Linux systems. Not all of it works on Macs or Windows operating systems, but most will. There are some documents available at the Bioperl web site that discuss using Bioperl on non-Unix computers, but the bottom line is that you might find that some things don't work.

If you're going to give Bioperl a try (and I strongly recommend you do), you should make sure you have a fairly recent version of Perl installed. You'll need at least Version 5.004; it would be much better to install the latest stable release from the Perl web site http://www.perl.com.

12.6.1 Sample Modules

To give you an idea of what tasks Bioperl can make easier for you, Table 12-1 displays a representative sample of some of the most useful modules available.

Table 12-1. Bioperl modules

Module	Description
Bio::Seq	Sequence object, with features
Bio::SimpleAlign	Multiple alignments held as a set of sequences
Bio::Species	Generic species object
Bio::DB::Ace	Database object interface to ACeDB servers
Bio::DB::GDB	Database object interface to GDB HTTP query
Bio::DB::GenBank	Database object interface to GenBank
Bio::DB::GenPept	Database object interface to GenPept
Bio::DB::NCBIHelper	A collection of routines useful for queries to NCBI databases
Bio::DB::SwissProt	Database object interface to SWISS-PROT retrieval
Bio::Index::Fasta	Interface for indexing FASTA files
Bio::Index::GenBank	Interface for indexing GenBank seq files, that is, flat files in GenBank format
Bio::Location::Simple	Implementation of a simple location on a sequence
Bio::Location::Split	Implementation of a location on a sequence that has multiple locations
Bio::SeqFeature::FeaturePair	Holds pair feature information, e.g., BLAST hits
Bio::SeqFeature::Generic	Generic SeqFeature
Bio::SeqFeature::Similarity	Sequence feature based on similarity
Bio::SeqFeature::SimilarityPair	Sequence feature based on the similarity of two sequences
Bio::SeqFeature::Gene::Exon	Feature representing an exon
Bio::SeqFeature::Gene::GeneStructure	Feature representing an arbitrarily complex structure of a gene
Bio::SeqFeature::Gene::Transcript	Feature representing a transcript
Bio::SeqFeature::Gene::TranscriptI	Interface for a feature representing a transcript of exons, promoter, UTR, and a poly-adenylation site
Bio::Tools::Blast	Bioperl BLAST sequence analysis object
Bio::Tools::BPbl2seq	Lightweight BLAST parser for pair-wise sequence alignment using the BLAST algorithm
Bio::Tools::BPlite	Lightweight BLAST parser
Bio::Tools::BPpsilite	Lightweight BLAST parser for PSIBLAST reports
Bio::Tools::CodonTable	Bioperl codon table object
Bio::Tools::Fasta	Bioperl FASTA utility object
Bio::Tools::IUPAC	Generates unique seq objects from an ambiguous seq object
Bio::Tools::RestrictionEnzyme	Bioperl object for a restriction endonuclease object
Bio::Tools::SeqPattern	Bioperl object for a sequence pattern or motif
Bio::Tools::SeqStats	Object holding statistics for one particular sequence
Bio::Tools::SeqWords	Object holding n-mer statistics for one sequence
Bio::Tools::Blast::HSP	Bioperl BLAST high-scoring segment pair object
Bio::Tools::Blast::HTML	Bioperl utility module for HTML-formatting BLAST reports
Bio::Tools::Blast::Sbjct	Bioperl BLAST "hit" object
Bio::Tools::Blast::Run::LocalBlast	Bioperl module for running BLAST analyses locally
Bio::Tools::Blast::Run::Webblast	Bioperl module for running BLAST analyses using an HTTP interface
Bio::Tools::Prediction::Exon	Predicted exon feature
Bio::Tools::Prediction::Gene	Predicted gene structure feature
Bio::Variation::AAChange	Sequence change class for polypeptides
Bio::Variation::AAReverseMutate	Point mutation and codon information from single amino acid changes
Bio::Variation::Allele	Sequence object with allele-specific attributes
Bio::Variation::DNAMutation	DNA-level mutation class
Bio::Variation::IO	Handler for sequence variation I/O formats

12.6.2 Bioperl Tutorial Script

Bioperl has a tutorial script to help you try out various parts of the package. In this section, I'll show how to start up and run some example computations.

I've mentioned already that you should learn how to download code from CPAN in order to add modules such as Bioperl. A great deal of the usefulness of the Perl programming environment now resides in these modules available on CPAN. This was a design decision: by concentrating on the core Perl language, the Perl designers can focus on making the language as good as they can. The Perl module developers can then concentrate on their many modules. By all means, take a look around the CPAN web site for an idea of the wealth of Perl modules available to you.

I won't give the details of how to install Bioperl here: as mentioned, they are available at the Bioperl web site, or you can visit the CPAN web site for information.

So, let's assume you've installed the Bioperl module and looked over the tutorial at the Bioperl web site. Now, let's see how to try out some Bioperl programs.

Go to the directory where the Bioperl software has been built on your system. For instance, on my Linux computer, I put the download file bioperl-0.7.0.tar.gz into the directory /usr/local/src, and then unpacked it with the command:

tar xvzf bioperl-0.7.0.tar.gz

which creates the source directory /usr/local/src/bioperl-0.7.0. After installing the module (check the documentation), you're ready to run the tutorial script.

Change to the source directory and type perl bptutorial.pl. Here's the result (I've shown the head of the tutorial to give the author and copyright information):

% head bptutorial.pl 
# $Id: ch12,v 1.44 2001/10/10 20:37:42 troutman Exp mam $

=head1  BioPerl Tutorial

  Cared for by Peter Schattner <schattner@alum.mit.edu>

  Copyright Peter Schattner

   This tutorial includes "snippets" of code and text from various
   Bioperl documents including module documentation, example scripts
% perl bptutorial.pl 

The following numeric arguments can be passed to run the corresponding demo-script.
1 => access_remote_db ,
2 => index_local_db ,
3 => fetch_local_db ,               (# NOTE: needs to be run with demo 2)
4 => sequence_manipulations ,
5 => seqstats_and_seqwords ,
6 => restriction_and_sigcleave ,
7 => other_seq_utilities ,
8 => run_standaloneblast ,
9 => blast_parser ,
10 => bplite_parsing ,
11 => hmmer_parsing ,
12 => run_clustalw_tcoffee ,
13 => run_psw_bl2seq ,
14 => simplealign_univaln ,
15 => gene_prediction_parsing ,
16 => sequence_annotation ,
17 => largeseqs ,
18 => liveseqs ,
19 => demo_variations ,
20 => demo_xml ,

In addition the argument "100" followed by the name of a single
bioperl object will display a list of all the public methods
available from that object and from what object they are inherited.

Using the parameter "0" will run all tests.
Using any other argument (or no argument) will run this display.

So typical command lines might be:
To run all demo scripts:
 > perl -w  bptutorial.pl 0
or to just run the local indexing demos:
 > perl -w  bptutorial.pl 2 3
or to list all the methods available for object Bio::Tools::SeqStats -
 > perl -w  bptutorial.pl 100 Bio::Tools::SeqStats

%

Now let's try option 9, the BLAST parser, and option 1, access_remote_db. So here goes, starting with the BLAST parser:

% perl bptutorial.pl 9

Beginning blast.pm parser example... 

QUERY NAME     : gi|1401126
QUERY DESC     : UNKNOWN
LENGTH         : 504
FILE           : t/blast.report
DATE           : Thu, 16 Apr 1998 18:56:18 -0400
PROGRAM        : TBLASTN
VERSION        : 2.0.4 [Feb-24-1998]</b>
DB-NAME        : Non-redundant GenBank+EMBL+DDBJ+PDB sequences
DB-RELEASE     : Apr 16, 1998  9:38 AM
DB-LETTERS     : 677679054
DB-SEQUENCES   : 336723
GAPPED         : YES
TOTAL HITS     : 100
CHECKED ALL    : YES
FILT FUNC      : NO
SIGNIF HITS    : 4
SIGNIF CUTOFF  : 1.0e-05 (EXPECT-VALUE)
LOWEST EXPECT  : 0.0
HIGHEST EXPECT : 1e-05
HIGHEST EXPECT : 7.6 (OVERALL)
MATRIX         : BLOSUM62
FILTER         : NONE
EXPECT         : 10
LAMBDA, K, H   : 0.270, 0.0470, 0.230 (SHARED STATS)
WORD SIZE      : 13
S              : 42, 74 (SHARED STATS)
GAP CREATION   : 11
GAP EXTENSION  : 1

Number of hits is 4 
Fraction identical for hit 1 is 0.25 
Sequence identities for hsp of hit 1 are 66-68 70 73 76 79 80 87-89 114 117
119 131 144 146 149 150 152 156 162 165 168 170 171 176 178-182 184 187 190
191 205-207 211 214 217 222 226 241 244 245 249 256 266-268 270 278 284 291
296 304 306 309 311 316 319 324 
%

This is an interesting way to parse BLAST output! Now let's look at the access of the remote DB:

% perl bptutorial.pl 1
Beginning remote database access example... 
seq1 display id is MUSIGHBA1 
seq2 display id is AF303112 
Display id of first sequence in stream is AF041456
% 

Well, that was less informative as an output, but it seems you can infer that the remote DB access was successful. (By the way, if you're unsuccessful with this, it may be that you're behind a firewall which is denying access—a not uncommon occurrence in universities or large companies.)

The documentation suggests running the bptutorial.pl script under the Perl debugger to watch what happens step by step. I concur with that suggestion but won't include the output here. Try it yourself!

Since that last example wasn't much fun, let's try one more: here's the sequence manipulation tutorial:

% perl bptutorial.pl 4

Beginning sequence_manipulations and SeqIO example... 
First sequence in fasta format... 
>Test1
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTC
TGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGG
TCACTAAATACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTAC
ACAACATCCATGAAACGCATTAGCACCACC
Seq object display id is Test1
Sequence is AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAG
CAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATA
GGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACC 
Sequence from 5 to 10 is TTTCAT 
Acc num is unknown 
Moltype is dna 
Primary id is Test1 
Truncated Seq object sequence is TTTCAT 
Reverse complemented sequence 5 to 10  is GTGCTA  
Translated sequence 6 to 15 is LQRAICLCVD 

Beginning 3-frame and alternate codon translation example... 
ctgagaaaataa translated using method defaults   : LRK*
ctgagaaaataa translated as a coding region (CDS): MRK

Translating in all six frames:
 frame: 0 forward: LRK*
 frame: 0 reverse-complement: LFSQ
 frame: 1 forward: *ENX
 frame: 1 reverse-complement: YFLX
 frame: 2 forward: EKI
 frame: 2 reverse-complement: IFS
Translating with all codon tables using method defaults:
1 : LRK*
2 : L*K*
3 : TRK*
4 : LRK*
5 : LSK*
6 : LRKQ
9 : LSN*
10 : LRK*
11 : LRK*
12 : SRK*
13 : LGK*
14 : LSNY
15 : LRK*
16 : LRK*
21 : LSN*
% 

That was more fun, because this part of Bioperl is doing several things we've done in this book.

I hope this brief look at Bioperl has whetted your appetite for more. It's a good idea to explore this set of modules. A Perl module for parsing BLAST output called BPLite.pm may also be of interest: it's now part of the Bioperl project.